Department Of Health And Family Welfare
- AOC value
- ₹62.16L
- AOC date
- Refer Docs
- Completion
- Refer Docs
- L1 bid
- Refer Docs
Timeline
- -Published
- -Closes
- -Bid opens
- -AOC date
- -Published
- -Closes
- -Bid opens
- -AOC date
Important info
- Result ID
- Refer Docs
- Award of contract
- Refer Docs
- Published
- Refer Docs
- Tender closed
- Refer Docs
- Tender no
- Bidding URL
- Tender
- Bidder details
AOC description
Department Of Health And Family Welfare has published Supply Of Kfd Rt-Pcr Reagents For Virus Diagnostic Laboratory Shimoga - Sequence Detetction Primer Kfdv Ns5f1 Tgg Aag Cct Ggc Tga Aag Ag 20 Bases 4304971 80000 Picomoles,Kfdv Ns5 R1-Tca Tcc Cca Ctg Acc Agc At 20 Bases Catalog No 4304971 80000 Picomoles,Taqman Qsy Probe-50Nm Kfdv Ns5 Probe 6Fam Atg Gag Agg Agc Gcc Tga Ccc G 22 Bases Catalog No 4482779 50000 Picomoles,Taqman Fast Virus 1 Step Master Mix For Qpcr Catalog Number 4444434 1 Qty 200X5,Actin Fp5ggcacccagcacaatgaag3 80000Picomoles,Actin Rp5gccgatccacacggagtact3 80000Picomoles,Beta Actin Qsy Probe Vic5tcaagatcattgctcctcctgagcgc3 50000Picomoles. Last date of submission for this tender is 2025-11-22. This is a Indicators And Reagents tender in Shivamogga, Karnataka
Free up your BG limit
Cover your EMD without touching your bank limit.
Get a quoteDocuments
1 issued- Tender Document 1htmlHTML document
Unlock the Tender details for free
Bidder Details
- Technical: clearedFinancial: clearedAOC: clearedBid value
- Technical: clearedFinancial: clearedAOC: not clearedBid value
- Technical: clearedFinancial: not clearedAOC: not clearedBid value
- Technical: not clearedFinancial: not clearedAOC: not clearedBid value
Unlock the Tender details for free